algorithms image lab software bio rad imagej nih rrid scr 001935 url (Bio-Rad)
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 
99
Structured Review
Bio-Rad
algorithms image lab software bio rad imagej nih rrid scr 001935 url
Algorithms Image Lab Software Bio Rad Imagej Nih Rrid Scr 001935 Url, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36402 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/imagej+nih+software/Image+Lab+Software/pm41512867-588-28-32
Average 99 stars, based on 36402 article reviews
Algorithms Image Lab Software Bio Rad Imagej Nih Rrid Scr 001935 Url, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 36402 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/imagej+nih+software/Image+Lab+Software/pm41512867-588-28-32
Average 99 stars, based on 36402 article reviews
algorithms image lab software bio rad imagej nih rrid scr 001935 url - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Detection Assay:Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and Activity Assay:Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and Iron Assay:Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and Software:Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and Article Title: Cross-species interactome analysis uncovers a conserved selective autophagy mechanism for protein quality control in plants. Article Snippet: .. REAGENT or Article Title: Ubiquitination-directed cytosolic DNA degradation governs cGAS-STING-mediated immune response to DNA damage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER plenti-hygro-GFP-SPOP This paper N/A lentiCRISPR v2 Addgene Cat# 52961 pLVX-IRES-Neo Clontech Cat# 632181 psPAX2 Addgene Cat# 12260 pMD2.G Addgene Cat# 12259 Software and Article Title: Optimized CRISPR-CAS double nickase systems, methods and compositions for sequence manipulation Article Snippet: Herculase II reaction buffer (5×; Agilent Technologies, included with polymerase) dNTP solution mix (25 mM each; Enzymatics, cat. no. N205L) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Taq Buffer (10×; Genscript, cat. no. B0005) SURVEYOR mutation detection kit for standard gel electrophoresis (Transgenomic, cat. no. 706025) UltraPure TBE buffer (10×; Life Technologies, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 4-20% TBE Gels 1.0 mm, 15 Well (Life Technologies, cat. no. EC62255BOX) Novex® Hi-Density TBE Sample Buffer (5×; Life Technologies, cat. no. LC6678) SYBR Gold Nucleic Acid Gel Stain (10,000×; Life Technologies, cat. no. S-11494) 1-kb Plus DNA ladder (Life Technologies, cat. no. 10787-018) TrackIt CyanOrange loading buffer (Life Technologies, cat. no. 10482-028) FastDigest HindIII (Fermentas/ThermoScientific, cat. no. FD0504) Equipment Filtered sterile pipette tips (Corning) Standard 1.5 ml microcentrifuge tubes (Eppendorf, cat. no. 0030 125.150) Axygen 96-well PCR plates (VWR, cat. no. PCR-96M2-HSC) Axygen 8-Strip PCR tubes (Fischer Scientific, cat. no. 14-222-250) Falcon tubes, polypropylene, 15 ml (BD Falcon, cat. no. 352097) Falcon tubes, polypropylene, 50 ml (BD Falcon, cat. no, 352070) Round-bottom Tube with cell strainer cap, 5 ml (BD Falcon, cat. no. 352235) Petri dishes (60 mm×15 mm; BD Biosciences, cat. no. 351007) Tissue culture plate (24 well; BD Falcon, cat. no. 353047) Tissue culture plate (96 well, flat bottom; BD Falcon, cat. no. 353075) Tissue culture dish (100 mm; BD Falcon, 353003) 96-well thermocycler with programmable temperature stepping functionality (Applied Biosystems Veriti, cat. no. 4375786). .. Desktop microcentrifuges 5424, 5804 (Eppendorf) Gel electrophoresis system (PowerPac basic power supply, Bio-Rad, cat. no. 164-5050, and Sub-Cell GT System gel tray, Bio-Rad, cat. no. 170-4401) Novex XCell SureLock Mini-Cell (Life Technologies, cat. no. EI0001) Digital gel imaging system (GelDoc EZ, Bio-Rad, cat. no. 170-8270, and blue sample tray, Bio-Rad, cat. no. 170-8273) Blue light transilluminator and orange filter goggles (SafeImager 2.0; Invitrogen, cat. no. G6600) Article Title: An mTOR-Stat3-Stathmin pathway controls centrosome and microtubule dynamics for oocyte polarization. Article Snippet: KASP-PCR was performed on an Applied Biosystems StepOnePlus machine and following the manufacturer instructions, using the following SNP sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAAAACTGAAACTAATATTTAGCTATTGCTTGGGTATAACCTCTTACTCATC CTCCACAGGACA[TGGAGCA/-]GAAGATGAAAATGTTGGA GAATCTGCAGGATGATTTTGATTTCAACTACAAAACTCTTAAGAGTG CTGGA .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Stathmin Forward: CAAGCCTGGAAC TCTCTGAAG; Reverse: CTGGATCTCCACCA AGGAAAG; Ddx4 Forward 5 ′ -GGTCGTGGA AAGATTGGCCTG-3 ′ ,Ddx4 Reverse 5 ′ -CAGCAGC CATTCTTTGAATATCTTC-3 ′ ; Beta actin Forward: 5 ′ -GGATTCGCTGGAGATGATGC; Reverse: 5 ′ – CGTGCTCGATGGGGTACTTC; HCR Probes: foxl2l; rec8a; dmc1 This paper; Molecular Instruments; Molecular Instruments; Molecular Instruments N/A; (accession #NM_001128810.1); (accession # XM_017359108.1); (#NM_001020782.1) KASP primer: stat3 stl27 Genotyping SNP primer sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAA AACTGAAACTAATATTTAGCTATTGCTTGGGTATAAC CTCTTACTCATCCTCCACAGGACA[TGGAGCA/-] GAAGATGAAAATGTTGGAGAATCTGCAGGATGATTTT GATTTCAACTACAAAACTCTTAAGAGTGCTGGA Kbioscience; This Paper N/A Software and Article Title: Reversal of diet-induced obesity by central insulin sensitizer FSTL1. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: C57BL/6J The GemPharmatech N000013 Mouse: db/db The GemPharmatech T002407 Mouse: ob/ob The GemPharmatech T001461 Mouse: AgRP-Cre Gift from Prof. Shu 61 N/A Mouse: Rosa26-tdTomato Gift from Prof. Guo 62 N/A Mouse: Fstl1 fl/fl Gift from Prof. Ning 63 N/A Oligonucleotides Pomc: Forward: CCTTGGCTAGATAACGAACTCTG Merck N/A Pomc: Reverse: AGATGACGTGGCAAAGAACAG Merck N/A Agrp: Forward: CCTCGTCGAACTCTATTCCCAG Merck N/A Agrp: Reverse: ACCAAGCCTACTACCATCATCG Merck N/A Npy: Forward: TAGGAGTAGTGCCCAAATGC Merck N/A Npy: Reverse: AAGAGCCTGGTCAAGTTCTG Merck N/A β-actin: Forward: CAGTGTCCATCCTCTGAGTAGC Merck N/A β-actin: Reverse: GGCATAAACGCAGAGCATTCCTG Merck N/A Software and Imaging:Article Title: The Ca 2+ sensor STIM1 promotes neuronal ferroptosis by regulating iron homeostasis to exacerbate brain injury after intracerebral hemorrhage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER GSH/GSSG ratio detection assay kit Abcam Cat# ab205811 GPX4 activity assay kit Elabscience Cat# E-BC-K883-M Iron Assay Kit Elabscience Cat# E-BC-K772-M Iron Assay Kit Elabscience Cat# E-BC-K880-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K773-M Ferrous Iron Assay Kit Elabscience Cat# E-BC-K881-M Experimental models: Cell lines Mouse HT22 cell line Procell Cat# CL-0697 Human HEK-293F cell line Thermo Fisher Scientific Cat# R79007 Experimental models: Organisms/strains C57BL/6J mouse Fourth Military Medical University N/A STIM1 flox/flox mouse Shanghai Model Organisms N/A Nestin-Cre +/− mouse Shanghai Model Organisms N/A STIM1 flox/flox /Nestin-Cre +/− mouse Shanghai Model Organisms N/A Oligonucleotides STIM1 flox Primer 1 (Forward), 5 ′ -CAGGTTCAGTGAGACCCTGTC-3 ′ This paper N/A STIM1 flox Primer 2 (Reverse), 5 ′ -GCCCACCAAGATCTCCACAA-3 ′ This paper N/A Nestin-Cre Primer 1, 5 ′ -TTGCTAAAGCGCTACATAGGA-3 ′ This paper N/A Nestin-Cre Primer 2, 5 ′ -CCTTCCTGAAGCAGTAGAGCA-3 ′ This paper N/A Nestin-Cre Primer 3, 5 ′ -GCCTTATTGTGGAAGGACTG-3 ′ This paper N/A shSTIM1: AGAAGGAGCTAGAATCTCAC This paper N/A shTFR1: CGTTGAATTGAACCTGGACTA This paper N/A ShNC: TTCTCCGAACGTGTCACGT This paper N/A Software and Article Title: Ubiquitination-directed cytosolic DNA degradation governs cGAS-STING-mediated immune response to DNA damage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER plenti-hygro-GFP-SPOP This paper N/A lentiCRISPR v2 Addgene Cat# 52961 pLVX-IRES-Neo Clontech Cat# 632181 psPAX2 Addgene Cat# 12260 pMD2.G Addgene Cat# 12259 Software and Article Title: Optimized CRISPR-CAS double nickase systems, methods and compositions for sequence manipulation Article Snippet: Herculase II reaction buffer (5×; Agilent Technologies, included with polymerase) dNTP solution mix (25 mM each; Enzymatics, cat. no. N205L) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Taq Buffer (10×; Genscript, cat. no. B0005) SURVEYOR mutation detection kit for standard gel electrophoresis (Transgenomic, cat. no. 706025) UltraPure TBE buffer (10×; Life Technologies, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 4-20% TBE Gels 1.0 mm, 15 Well (Life Technologies, cat. no. EC62255BOX) Novex® Hi-Density TBE Sample Buffer (5×; Life Technologies, cat. no. LC6678) SYBR Gold Nucleic Acid Gel Stain (10,000×; Life Technologies, cat. no. S-11494) 1-kb Plus DNA ladder (Life Technologies, cat. no. 10787-018) TrackIt CyanOrange loading buffer (Life Technologies, cat. no. 10482-028) FastDigest HindIII (Fermentas/ThermoScientific, cat. no. FD0504) Equipment Filtered sterile pipette tips (Corning) Standard 1.5 ml microcentrifuge tubes (Eppendorf, cat. no. 0030 125.150) Axygen 96-well PCR plates (VWR, cat. no. PCR-96M2-HSC) Axygen 8-Strip PCR tubes (Fischer Scientific, cat. no. 14-222-250) Falcon tubes, polypropylene, 15 ml (BD Falcon, cat. no. 352097) Falcon tubes, polypropylene, 50 ml (BD Falcon, cat. no, 352070) Round-bottom Tube with cell strainer cap, 5 ml (BD Falcon, cat. no. 352235) Petri dishes (60 mm×15 mm; BD Biosciences, cat. no. 351007) Tissue culture plate (24 well; BD Falcon, cat. no. 353047) Tissue culture plate (96 well, flat bottom; BD Falcon, cat. no. 353075) Tissue culture dish (100 mm; BD Falcon, 353003) 96-well thermocycler with programmable temperature stepping functionality (Applied Biosystems Veriti, cat. no. 4375786). .. Desktop microcentrifuges 5424, 5804 (Eppendorf) Gel electrophoresis system (PowerPac basic power supply, Bio-Rad, cat. no. 164-5050, and Sub-Cell GT System gel tray, Bio-Rad, cat. no. 170-4401) Novex XCell SureLock Mini-Cell (Life Technologies, cat. no. EI0001) Digital gel imaging system (GelDoc EZ, Bio-Rad, cat. no. 170-8270, and blue sample tray, Bio-Rad, cat. no. 170-8273) Blue light transilluminator and orange filter goggles (SafeImager 2.0; Invitrogen, cat. no. G6600) Article Title: Reversal of diet-induced obesity by central insulin sensitizer FSTL1. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Organisms/strains Mouse: C57BL/6J The GemPharmatech N000013 Mouse: db/db The GemPharmatech T002407 Mouse: ob/ob The GemPharmatech T001461 Mouse: AgRP-Cre Gift from Prof. Shu 61 N/A Mouse: Rosa26-tdTomato Gift from Prof. Guo 62 N/A Mouse: Fstl1 fl/fl Gift from Prof. Ning 63 N/A Oligonucleotides Pomc: Forward: CCTTGGCTAGATAACGAACTCTG Merck N/A Pomc: Reverse: AGATGACGTGGCAAAGAACAG Merck N/A Agrp: Forward: CCTCGTCGAACTCTATTCCCAG Merck N/A Agrp: Reverse: ACCAAGCCTACTACCATCATCG Merck N/A Npy: Forward: TAGGAGTAGTGCCCAAATGC Merck N/A Npy: Reverse: AAGAGCCTGGTCAAGTTCTG Merck N/A β-actin: Forward: CAGTGTCCATCCTCTGAGTAGC Merck N/A β-actin: Reverse: GGCATAAACGCAGAGCATTCCTG Merck N/A Software and other:Article Title: Functional genomics using CRISPR-Cas systems, compositions, methods, knock out libraries and applications thereof Article Snippet: 23| Applicants spun down the new tube at 200×g for 5 m. Applicants prepared the transfection solution by mixing the SF solution and S1 supplement as recommended by Amaxa. Article Title: Clec16a maintains definitive hematopoietic stem and progenitor cells via mitophagy. Article Snippet: This study (primer sequences listed in Table S2) See Table S2 clec16a-spMO — translation blocking morpholino (zebrafish) GeneTools (custom synthesis) 5’-TGCCCCAGCAAATGCATCT TACCTC-3’ Control-MO — standard negative control morpholino GeneTools (standard control) Standard control sgRNA2 (CLEC16A) — CRISPR guide used for KO Lent-U6-sgRNA-EF1S-spCas9-P2ABlasticidin (TransheepBio, Shanghai) sgRNA2: 5’-AACGGATGGTC TCCACTAGC-3’ sgRNA3 (CLEC16A) — CRISPR guide used for KO Lent-U6-sgRNA-EF1S-spCas9-P2ABlasticidin (TransheepBio) sgRNA3: 5’-GCAGCTGAACGCA CACGTAA-3’ Genotyping PCR primers for CLEC16A KO This paper Forward: 5’-TGATTCAGTTCTCC GGGTGG-3’ ; Reverse: 5’-CGCAG ACACAGAAAACCACG-3’ USP8 siRNA (Silencer® pre-designed siRNA) Thermo Fisher Scientific Cat# AM51331 siNC (negative control siRNA; used in parallel to USP8 knockdown) Thermo Fisher Scientific (matching negative control used with Ambion siRNAs) N/A Recombinant DNA Lent-U6-sgRNA-EF1S-spCas9-P2ABlasticidin (sgRNA2 + sgRNA3 used for CLEC16A KO) TransheepBio (Shanghai, China) N/A HA-tagged wild-type ubiquitin (HA-Ub) TransheepBio (Shanghai, China) N/A HA-tagged K48-only ubiquitin (HA-K48) TransheepBio (Shanghai, China) N/A HA-tagged K63-only ubiquitin (HA-K63) TransheepBio (Shanghai, China) N/A CLEC16A IVT template plasmid (for zebrafish mRNA rescue) TransheepBio (Shanghai, China) N/A ATG5 IVT template plasmid (for zebrafish atg5 mRNA rescue) TransheepBio (Shanghai, China) N/A Software and algorithms R The R Project R: v4.2.3; RRID:SCR_001905 DESeq2 Bioconductor DESeq2: v1.22.2 FastQC FastQC FastQC: v0.10.1 Cutadapt Cutadapt Cutadapt: v4.2 HISAT2 HISAT2 HISAT2: v2.2.1 StringTie StringTie StringTie: v2.1.6 rMATS rMATS rMATS: v4.1.1 ProteoWizard (msconvert) ProteoWizard ProteoWizard: v3.0.22110 MetaboAnalyst MetaboAnalyst MetaboAnalyst: v5.0 DIA-NN DIA-NN DIA-NN: v1.8 Thermo Proteome Discoverer Thermo Thermo PD: v2.5 Spectronaut Biognosys Spectronaut: v16 Novogene PD-based workflow Novogene Novogene PD: v2024.04 OmicStudio (LC-Bio cloud) LC-Bio OmicStudio: N/A Bio-Rad CFX Maestro Bio-Rad Bio-Rad CFX Maestro: v4.1.2433.1219 ImageJ / Fiji NIH / Fiji ImageJ / Fiji: v1.54j GraphPad Prism GraphPad Software GraphPad Prism: v9.0.0 Adobe Photoshop Adobe Adobe Photoshop: v26.7.0 (Continued on next page) Cell Reports 45, 116978, March 24, 2026 21 Light Microscopy:Article Title: Ubiquitination-directed cytosolic DNA degradation governs cGAS-STING-mediated immune response to DNA damage. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER plenti-hygro-GFP-SPOP This paper N/A lentiCRISPR v2 Addgene Cat# 52961 pLVX-IRES-Neo Clontech Cat# 632181 psPAX2 Addgene Cat# 12260 pMD2.G Addgene Cat# 12259 Software and Nucleic Acid Electrophoresis:Article Title: Optimized CRISPR-CAS double nickase systems, methods and compositions for sequence manipulation Article Snippet: Herculase II reaction buffer (5×; Agilent Technologies, included with polymerase) dNTP solution mix (25 mM each; Enzymatics, cat. no. N205L) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Taq Buffer (10×; Genscript, cat. no. B0005) SURVEYOR mutation detection kit for standard gel electrophoresis (Transgenomic, cat. no. 706025) UltraPure TBE buffer (10×; Life Technologies, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 4-20% TBE Gels 1.0 mm, 15 Well (Life Technologies, cat. no. EC62255BOX) Novex® Hi-Density TBE Sample Buffer (5×; Life Technologies, cat. no. LC6678) SYBR Gold Nucleic Acid Gel Stain (10,000×; Life Technologies, cat. no. S-11494) 1-kb Plus DNA ladder (Life Technologies, cat. no. 10787-018) TrackIt CyanOrange loading buffer (Life Technologies, cat. no. 10482-028) FastDigest HindIII (Fermentas/ThermoScientific, cat. no. FD0504) Equipment Filtered sterile pipette tips (Corning) Standard 1.5 ml microcentrifuge tubes (Eppendorf, cat. no. 0030 125.150) Axygen 96-well PCR plates (VWR, cat. no. PCR-96M2-HSC) Axygen 8-Strip PCR tubes (Fischer Scientific, cat. no. 14-222-250) Falcon tubes, polypropylene, 15 ml (BD Falcon, cat. no. 352097) Falcon tubes, polypropylene, 50 ml (BD Falcon, cat. no, 352070) Round-bottom Tube with cell strainer cap, 5 ml (BD Falcon, cat. no. 352235) Petri dishes (60 mm×15 mm; BD Biosciences, cat. no. 351007) Tissue culture plate (24 well; BD Falcon, cat. no. 353047) Tissue culture plate (96 well, flat bottom; BD Falcon, cat. no. 353075) Tissue culture dish (100 mm; BD Falcon, 353003) 96-well thermocycler with programmable temperature stepping functionality (Applied Biosystems Veriti, cat. no. 4375786). .. Desktop microcentrifuges 5424, 5804 (Eppendorf) Gel electrophoresis system (PowerPac basic power supply, Bio-Rad, cat. no. 164-5050, and Sub-Cell GT System gel tray, Bio-Rad, cat. no. 170-4401) Novex XCell SureLock Mini-Cell (Life Technologies, cat. no. EI0001) Digital gel imaging system (GelDoc EZ, Bio-Rad, cat. no. 170-8270, and blue sample tray, Bio-Rad, cat. no. 170-8273) Blue light transilluminator and orange filter goggles (SafeImager 2.0; Invitrogen, cat. no. G6600) Spectrophotometry:Article Title: Optimized CRISPR-CAS double nickase systems, methods and compositions for sequence manipulation Article Snippet: Herculase II reaction buffer (5×; Agilent Technologies, included with polymerase) dNTP solution mix (25 mM each; Enzymatics, cat. no. N205L) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Taq Buffer (10×; Genscript, cat. no. B0005) SURVEYOR mutation detection kit for standard gel electrophoresis (Transgenomic, cat. no. 706025) UltraPure TBE buffer (10×; Life Technologies, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 4-20% TBE Gels 1.0 mm, 15 Well (Life Technologies, cat. no. EC62255BOX) Novex® Hi-Density TBE Sample Buffer (5×; Life Technologies, cat. no. LC6678) SYBR Gold Nucleic Acid Gel Stain (10,000×; Life Technologies, cat. no. S-11494) 1-kb Plus DNA ladder (Life Technologies, cat. no. 10787-018) TrackIt CyanOrange loading buffer (Life Technologies, cat. no. 10482-028) FastDigest HindIII (Fermentas/ThermoScientific, cat. no. FD0504) Equipment Filtered sterile pipette tips (Corning) Standard 1.5 ml microcentrifuge tubes (Eppendorf, cat. no. 0030 125.150) Axygen 96-well PCR plates (VWR, cat. no. PCR-96M2-HSC) Axygen 8-Strip PCR tubes (Fischer Scientific, cat. no. 14-222-250) Falcon tubes, polypropylene, 15 ml (BD Falcon, cat. no. 352097) Falcon tubes, polypropylene, 50 ml (BD Falcon, cat. no, 352070) Round-bottom Tube with cell strainer cap, 5 ml (BD Falcon, cat. no. 352235) Petri dishes (60 mm×15 mm; BD Biosciences, cat. no. 351007) Tissue culture plate (24 well; BD Falcon, cat. no. 353047) Tissue culture plate (96 well, flat bottom; BD Falcon, cat. no. 353075) Tissue culture dish (100 mm; BD Falcon, 353003) 96-well thermocycler with programmable temperature stepping functionality (Applied Biosystems Veriti, cat. no. 4375786). .. Desktop microcentrifuges 5424, 5804 (Eppendorf) Gel electrophoresis system (PowerPac basic power supply, Bio-Rad, cat. no. 164-5050, and Sub-Cell GT System gel tray, Bio-Rad, cat. no. 170-4401) Novex XCell SureLock Mini-Cell (Life Technologies, cat. no. EI0001) Digital gel imaging system (GelDoc EZ, Bio-Rad, cat. no. 170-8270, and blue sample tray, Bio-Rad, cat. no. 170-8273) Blue light transilluminator and orange filter goggles (SafeImager 2.0; Invitrogen, cat. no. G6600) Electrophoresis:Article Title: Optimized CRISPR-CAS double nickase systems, methods and compositions for sequence manipulation Article Snippet: Herculase II reaction buffer (5×; Agilent Technologies, included with polymerase) dNTP solution mix (25 mM each; Enzymatics, cat. no. N205L) QIAquick gel extraction kit (Qiagen, cat. no. 28704) Taq Buffer (10×; Genscript, cat. no. B0005) SURVEYOR mutation detection kit for standard gel electrophoresis (Transgenomic, cat. no. 706025) UltraPure TBE buffer (10×; Life Technologies, cat. no. 15581-028) SeaKem LE agarose (Lonza, cat. no. 50004) 4-20% TBE Gels 1.0 mm, 15 Well (Life Technologies, cat. no. EC62255BOX) Novex® Hi-Density TBE Sample Buffer (5×; Life Technologies, cat. no. LC6678) SYBR Gold Nucleic Acid Gel Stain (10,000×; Life Technologies, cat. no. S-11494) 1-kb Plus DNA ladder (Life Technologies, cat. no. 10787-018) TrackIt CyanOrange loading buffer (Life Technologies, cat. no. 10482-028) FastDigest HindIII (Fermentas/ThermoScientific, cat. no. FD0504) Equipment Filtered sterile pipette tips (Corning) Standard 1.5 ml microcentrifuge tubes (Eppendorf, cat. no. 0030 125.150) Axygen 96-well PCR plates (VWR, cat. no. PCR-96M2-HSC) Axygen 8-Strip PCR tubes (Fischer Scientific, cat. no. 14-222-250) Falcon tubes, polypropylene, 15 ml (BD Falcon, cat. no. 352097) Falcon tubes, polypropylene, 50 ml (BD Falcon, cat. no, 352070) Round-bottom Tube with cell strainer cap, 5 ml (BD Falcon, cat. no. 352235) Petri dishes (60 mm×15 mm; BD Biosciences, cat. no. 351007) Tissue culture plate (24 well; BD Falcon, cat. no. 353047) Tissue culture plate (96 well, flat bottom; BD Falcon, cat. no. 353075) Tissue culture dish (100 mm; BD Falcon, 353003) 96-well thermocycler with programmable temperature stepping functionality (Applied Biosystems Veriti, cat. no. 4375786). .. Desktop microcentrifuges 5424, 5804 (Eppendorf) Gel electrophoresis system (PowerPac basic power supply, Bio-Rad, cat. no. 164-5050, and Sub-Cell GT System gel tray, Bio-Rad, cat. no. 170-4401) Novex XCell SureLock Mini-Cell (Life Technologies, cat. no. EI0001) Digital gel imaging system (GelDoc EZ, Bio-Rad, cat. no. 170-8270, and blue sample tray, Bio-Rad, cat. no. 170-8273) Blue light transilluminator and orange filter goggles (SafeImager 2.0; Invitrogen, cat. no. G6600) Sequencing:Article Title: An mTOR-Stat3-Stathmin pathway controls centrosome and microtubule dynamics for oocyte polarization. Article Snippet: KASP-PCR was performed on an Applied Biosystems StepOnePlus machine and following the manufacturer instructions, using the following SNP sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAAAACTGAAACTAATATTTAGCTATTGCTTGGGTATAACCTCTTACTCATC CTCCACAGGACA[TGGAGCA/-]GAAGATGAAAATGTTGGA GAATCTGCAGGATGATTTTGATTTCAACTACAAAACTCTTAAGAGTG CTGGA .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides Primer: Stathmin Forward: CAAGCCTGGAAC TCTCTGAAG; Reverse: CTGGATCTCCACCA AGGAAAG; Ddx4 Forward 5 ′ -GGTCGTGGA AAGATTGGCCTG-3 ′ ,Ddx4 Reverse 5 ′ -CAGCAGC CATTCTTTGAATATCTTC-3 ′ ; Beta actin Forward: 5 ′ -GGATTCGCTGGAGATGATGC; Reverse: 5 ′ – CGTGCTCGATGGGGTACTTC; HCR Probes: foxl2l; rec8a; dmc1 This paper; Molecular Instruments; Molecular Instruments; Molecular Instruments N/A; (accession #NM_001128810.1); (accession # XM_017359108.1); (#NM_001020782.1) KASP primer: stat3 stl27 Genotyping SNP primer sequence: ATGCATGTTATAACAATCTGAAAACTGAAAATACTAA AACTGAAACTAATATTTAGCTATTGCTTGGGTATAAC CTCTTACTCATCCTCCACAGGACA[TGGAGCA/-] GAAGATGAAAATGTTGGAGAATCTGCAGGATGATTTT GATTTCAACTACAAAACTCTTAAGAGTGCTGGA Kbioscience; This Paper N/A Software and |